FileXXXXXXXXXXX

File manager - Edit - /var/www/payraty/helpdesk/public/storage/branding_media/images/network.zip

Back
PK��!�#��if-post-down.d/chronynu�ȯ��#!/bin/sh set -e [ -x /usr/sbin/chronyd ] \|\| exit 0 if [ -e /run/chrony/chronyd.pid ]; then chronyc onoffline > /dev/null 2>&1 fi exit 0 PK��!��mX��X��if-pre-up.d/ethtoolnu�ȯ��#!/bin/sh ETHTOOL=/sbin/ethtool test -x $ETHTOOL \|\| exit 0 [ "$IFACE" != "lo" ] \|\| exit 0 # Gather together the mixed bag of settings applied with -s/--change SETTINGS="\ ${IF_ETHERNET_PORT:+ port $IF_ETHERNET_PORT}\ ${IF_DRIVER_MESSAGE_LEVEL:+ msglvl $IF_DRIVER_MESSAGE_LEVEL}\ " [ -z "$SETTINGS" ] \|\| $ETHTOOL --change "$IFACE" $SETTINGS PK��!�~��if-up.d/ethtoolnu�ȯ��#!/bin/sh ETHTOOL=/sbin/ethtool test -x $ETHTOOL \|\| exit 0 [ "$IFACE" != "lo" ] \|\| exit 0 # Find settings with a given prefix and print them as they appeared in # /etc/network/interfaces, only with the prefix removed. # This actually prints each name and value on a separate line, but that # doesn't matter to the shell. gather_settings () { set \| sed -n " /^IF_$1[A-Za-z0-9_]=/ { h; # hold line s/^IF_$1//; s/=.//; s/_/-/g; # get name without prefix y/ABCDEFGHIJKLMNOPQRSTUVWXYZ/abcdefghijklmnopqrstuvwxyz/; # lower-case p; g; # restore line s/^[^=]=//; s/^'$.$'/\1/; # get value p; }" } # Gather together the mixed bag of settings applied with -s/--change SETTINGS="\ ${IF_LINK_SPEED:+ speed $IF_LINK_SPEED}\ ${IF_LINK_DUPLEX:+ duplex $IF_LINK_DUPLEX}\ " # WOL has an optional pass-key set -- $IF_ETHERNET_WOL SETTINGS="$SETTINGS${1:+ wol $1}${2:+ sopass $2}" # Autonegotiation can be on\|off or an advertising mask case "$IF_ETHERNET_AUTONEG" in '') ;; on\|off) SETTINGS="$SETTINGS autoneg $IF_ETHERNET_AUTONEG" ;; ) SETTINGS="$SETTINGS autoneg on advertise $IF_ETHERNET_AUTONEG" ;; esac [ -z "$SETTINGS" ] \|\| $ETHTOOL --change "$IFACE" $SETTINGS SETTINGS="$(gather_settings ETHERNET_PAUSE_)" [ -z "$SETTINGS" ] \|\| $ETHTOOL --pause "$IFACE" $SETTINGS SETTINGS="$(gather_settings HARDWARE_IRQ_COALESCE_)" [ -z "$SETTINGS" ] \|\| $ETHTOOL --coalesce "$IFACE" $SETTINGS SETTINGS="$(gather_settings HARDWARE_DMA_RING_)" [ -z "$SETTINGS" ] \|\| $ETHTOOL --set-ring "$IFACE" $SETTINGS SETTINGS="$(gather_settings OFFLOAD_)" [ -z "$SETTINGS" ] \|\| $ETHTOOL --offload "$IFACE" $SETTINGS PK��!�#��if-up.d/chronynu�ȯ��#!/bin/sh set -e [ -x /usr/sbin/chronyd ] \|\| exit 0 if [ -e /run/chrony/chronyd.pid ]; then chronyc onoffline > /dev/null 2>&1 fi exit 0 PK��!�� ¸��80-vm-vt.networknu��[��# SPDX-License-Identifier: LGPL-2.1-or-later # # This file is part of systemd. # # systemd is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 2.1 of the License, or # (at your option) any later version. # This network file matches vt- TUN/TAP devices and applies a similar # configuration as ve-* to provide NAT/DHCP to VMs. [Match] Name=vt-* Driver=tun [Network] # Default to using a /28 prefix, giving up to 13 addresses per VM. Address=0.0.0.0/28 LinkLocalAddressing=yes DHCPServer=yes IPMasquerade=both LLDP=yes EmitLLDP=customer-bridge IPv6SendRA=yes PK��!�~��80-container-host0.networknu��[��# SPDX-License-Identifier: LGPL-2.1-or-later # # This file is part of systemd. # # systemd is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 2.1 of the License, or # (at your option) any later version. # This network file matches the container-side of the virtual Ethernet link # created by systemd-nspawn's --network-veth switch. See systemd-nspawn(1) for # details. [Match] Virtualization=container Name=host0 [Network] DHCP=yes LinkLocalAddressing=yes LLDP=yes EmitLLDP=customer-bridge [DHCP] UseTimezone=yes PK��!�kb!{N��N��80-wifi-adhoc.networknu��[��[Match] Type=wlan WLANInterfaceType=ad-hoc [Network] LinkLocalAddressing=yes PK��!��80-container-vz.networknu��[��# SPDX-License-Identifier: LGPL-2.1-or-later # # This file is part of systemd. # # systemd is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 2.1 of the License, or # (at your option) any later version. # This network file matches the bridge interface created by systemd-nspawn's # --network-zone= switch. See systemd-nspawn(1) for details. [Match] Name=vz-* Driver=bridge [Network] # Default to using a /24 prefix, giving up to 253 addresses per virtual network. Address=0.0.0.0/24 LinkLocalAddressing=yes DHCPServer=yes IPMasquerade=both LLDP=yes EmitLLDP=customer-bridge IPv6SendRA=yes PK��!��n��80-container-ve.networknu��[��# SPDX-License-Identifier: LGPL-2.1-or-later # # This file is part of systemd. # # systemd is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 2.1 of the License, or # (at your option) any later version. # This network file matches the host-side of the virtual Ethernet link # created by systemd-nspawn's --network-veth switch. See systemd-nspawn(1) for # details. [Match] Name=ve-* Driver=veth [Network] # Default to using a /28 prefix, giving up to 13 addresses per container. Address=0.0.0.0/28 LinkLocalAddressing=yes DHCPServer=yes IPMasquerade=both LLDP=yes EmitLLDP=customer-bridge IPv6SendRA=yes PK��!�K�3,��,��73-usb-net-by-mac.linknu��[��[Match] Path=-usb- [Link] NamePolicy=mac PK��!��H��99-default.linknu��[��# SPDX-License-Identifier: LGPL-2.1-or-later # # This file is part of systemd. # # systemd is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 2.1 of the License, or # (at your option) any later version. [Match] OriginalName=* [Link] NamePolicy=keep kernel database onboard slot path AlternativeNamesPolicy=database onboard slot path MACAddressPolicy=persistent PK��!�8�Sf��f��80-wifi-ap.network.examplenu��[��[Match] Type=wlan WLANInterfaceType=ap [Network] Address=0.0.0.0/24 DHCPServer=yes IPMasquerade=both PK��!��@��@��80-wifi-station.network.examplenu��[��[Match] Type=wlan WLANInterfaceType=station [Network] DHCP=yes PK��!��9#��protbase.awknu��[��{ request = request "\n" $0 } END { BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80" printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" \|& BLASTService printf "Content-Length: " length(request) "\n\n" \|& BLASTService printf request \|& BLASTService while ((BLASTService \|& getline) > 0) print $0 close(BLASTService) } PK��!�w�5�_ ��_ ��maze.awknu��[��function SetUpServer() { TopHeader = "<HTML><title>Walk through a maze</title>" TopDoc = "\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\ <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\ </UL>" TopFooter = "</HTML>" srand() } function HandleGET() { if (MENU[2] == "AboutServer") { Document = "If your browser has a VRML 2 plugin,\ this server shows you a simple VRML scene." } else if (MENU[2] == "VRMLtest") { XSIZE = YSIZE = 11 # initially, everything is wall for (y = 0; y < YSIZE; y++) for (x = 0; x < XSIZE; x++) Maze[x, y] = "#" delete Maze[0, 1] # entry is not wall delete Maze[XSIZE-1, YSIZE-2] # exit is not wall MakeMaze(1, 1) Document = "\ #VRML V2.0 utf8\n\ Group {\n\ children [\n\ PointLight {\n\ ambientIntensity 0.2\n\ color 0.7 0.7 0.7\n\ location 0.0 8.0 10.0\n\ }\n\ DEF B1 Background {\n\ skyColor [0 0 0, 1.0 1.0 1.0 ]\n\ skyAngle 1.6\n\ groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\ groundAngle [ 1.2 1.57 ]\n\ }\n\ DEF Wall Shape {\n\ geometry Box {size 1 1 1}\n\ appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\ }\n\ DEF Entry Viewpoint {\n\ position 0.5 1.0 5.0\n\ orientation 0.0 0.0 -1.0 0.52\n\ }\n" for (i in Maze) { split(i, t, SUBSEP) Document = Document " Transform { translation " Document = Document t[1] " 0 -" t[2] " children USE Wall }\n" } Document = Document " ] # end of group for world\n}" Reason = "OK" ORS "Content-type: model/vrml" Header = Footer = "" } } function MakeMaze(x, y) { delete Maze[x, y] # here we are, we have no wall here p = 0 # count unvisited fields in all directions if (x-2 SUBSEP y in Maze) d[p++] = "-x" if (x SUBSEP y-2 in Maze) d[p++] = "-y" if (x+2 SUBSEP y in Maze) d[p++] = "+x" if (x SUBSEP y+2 in Maze) d[p++] = "+y" if (p>0) { # if there are unvisited fields, go there p = int(prand()) # choose one unvisited field at random if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y) } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2) } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y) } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2) } # we are back from recursion MakeMaze(x, y); # try again while there are unvisited fields } } PK��!��'��'�� eliza.awknu��[��function SetUpServer() { SetUpEliza() TopHeader = \ "<HTML><title>An HTTP-based System with GAWK</title>\ <HEAD><META HTTP-EQUIV=\"Content-Type\"\ CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\ <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\ LINK=\"#0000ff\" VLINK=\"#0000ff\"\ ALINK=\"#0000ff\"> <A NAME=\"top\">" TopDoc = "\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI>\ <A HREF=" MyPrefix "/AboutServer>About this server</A>\ </LI><LI>\ <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\ <LI>\ <A HREF=" MyPrefix \ "/StartELIZA>Start talking to Eliza</A></LI></UL>" TopFooter = "</BODY></HTML>" } function HandleGET() { # A real HTTP server would treat some parts of the URI as a file name. # We take parts of the URI as menu choices and go on accordingly. if (MENU[2] == "AboutServer") { Document = "This is not a CGI script.\ This is an httpd, an HTML file, and a CGI script all \ in one GAWK script. It needs no separate www-server, \ no installation, and no root privileges.\ <p>To run it, do this:</p><ul>\ <li> start this script with \"gawk -f httpserver.awk\",</li>\ <li> and on the same host let your www browser open location\ \"http://localhost:8080\"</li>\ </ul>\<p>\ Details of HTTP come from:</p><ul>\ <li>Hethmon: Illustrated Guide to HTTP</p>\ <li>RFC 2068</li></ul><p>JK 14.9.1997</p>" } else if (MENU[2] == "AboutELIZA") { Document = "This is an implementation of the famous ELIZA\ program by Joseph Weizenbaum. It is written in GAWK and\ uses an HTML GUI." } else if (MENU[2] == "StartELIZA") { gsub(/\+/, " ", GETARG["YouSay"]) # Here we also have to substitute coded special characters Document = "<form method=GET>" \ "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\ <p><input type=text name=YouSay value=\"\" size=60>\ <br><input type=submit value=\"Tell her about it\"></p></form>" } } function ElizaSays(YouSay) { if (YouSay == "") { cost = 0 answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM" } else { q = toupper(YouSay) gsub("'", "", q) if (q == qold) { answer = "PLEASE DONT REPEAT YOURSELF !" } else { if (index(q, "SHUT UP") > 0) { answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\ int(100rand()+30+cost/100) } else { qold = q w = "-" # no keyword recognized yet for (i in k) { # search for keywords if (index(q, i) > 0) { w = i break } } if (w == "-") { # no keyword, take old subject w = wold subj = subjold } else { # find subject subj = substr(q, index(q, w) + length(w)+1) wold = w subjold = subj # remember keyword and subject } for (i in conj) gsub(i, conj[i], q) # conjugation # from all answers to this keyword, select one randomly answer = r[indices[int(split(k[w], indices) * rand()) + 1]] # insert subject into answer gsub("_", subj, answer) } } } cost += length(answer) # for later payment : 1 cent per character return answer } function SetUpEliza() { srand() wold = "-" subjold = " " # table for conjugation conj[" ARE " ] = " AM " conj["WERE " ] = "WAS " conj[" YOU " ] = " I " conj["YOUR " ] = "MY " conj[" IVE " ] =\ conj[" I HAVE " ] = " YOU HAVE " conj[" YOUVE " ] =\ conj[" YOU HAVE "] = " I HAVE " conj[" IM " ] =\ conj[" I AM " ] = " YOU ARE " conj[" YOURE " ] =\ conj[" YOU ARE " ] = " I AM " # table of all answers r[1] = "DONT YOU BELIEVE THAT I CAN _" r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?" r[3] = "YOU WANT ME TO BE ABLE TO _ ?" r[4] = "PERHAPS YOU DONT WANT TO _ " r[5] = "DO YOU WANT TO BE ABLE TO _ ?" r[6] = "WHAT MAKES YOU THINK I AM _ ?" r[7] = "DOES IT PLEASE YOU TO BELIEVE I AM _ ?" r[8] = "PERHAPS YOU WOULD LIKE TO BE _ ?" r[9] = "DO YOU SOMETIMES WISH YOU WERE _ ?" r[10] = "DONT YOU REALLY _ ?" r[11] = "WHY DONT YOU _ ?" r[12] = "DO YOU WISH TO BE ABLE TO _ ?" r[13] = "DOES THAT TROUBLE YOU ?" r[14] = "TELL ME MORE ABOUT SUCH FEELINGS" r[15] = "DO YOU OFTEN FEEL _ ?" r[16] = "DO YOU ENJOY FEELING _ ?" r[17] = "DO YOU REALLY BELIEVE I DONT _ ?" r[18] = "PERHAPS IN GOOD TIME I WILL _ " r[19] = "DO YOU WANT ME TO _ ?" r[20] = "DO YOU THINK YOU SHOULD BE ABLE TO _ ?" r[21] = "WHY CANT YOU _ ?" r[22] = "WHY ARE YOU INTERESTED IN WHETHER OR NOT I AM _ ?" r[23] = "WOULD YOU PREFER IF I WERE NOT _ ?" r[24] = "PERHAPS IN YOUR FANTASIES I AM _ " r[25] = "HOW DO YOU KNOW YOU CANT _ ?" r[26] = "HAVE YOU TRIED ?" r[27] = "PERHAPS YOU CAN NOW _ " r[28] = "DID YOU COME TO ME BECAUSE YOU ARE _ ?" r[29] = "HOW LONG HAVE YOU BEEN _ ?" r[30] = "DO YOU BELIEVE ITS NORMAL TO BE _ ?" r[31] = "DO YOU ENJOY BEING _ ?" r[32] = "WE WERE DISCUSSING YOU -- NOT ME" r[33] = "Oh, I _" r[34] = "YOU'RE NOT REALLY TALKING ABOUT ME, ARE YOU ?" r[35] = "WHAT WOULD IT MEAN TO YOU, IF YOU GOT _ ?" r[36] = "WHY DO YOU WANT _ ?" r[37] = "SUPPOSE YOU SOON GOT _" r[38] = "WHAT IF YOU NEVER GOT _ ?" r[39] = "I SOMETIMES ALSO WANT _" r[40] = "WHY DO YOU ASK ?" r[41] = "DOES THAT QUESTION INTEREST YOU ?" r[42] = "WHAT ANSWER WOULD PLEASE YOU THE MOST ?" r[43] = "WHAT DO YOU THINK ?" r[44] = "ARE SUCH QUESTIONS IN YOUR MIND OFTEN ?" r[45] = "WHAT IS IT THAT YOU REALLY WANT TO KNOW ?" r[46] = "HAVE YOU ASKED ANYONE ELSE ?" r[47] = "HAVE YOU ASKED SUCH QUESTIONS BEFORE ?" r[48] = "WHAT ELSE COMES TO MIND WHEN YOU ASK THAT ?" r[49] = "NAMES DON'T INTEREST ME" r[50] = "I DONT CARE ABOUT NAMES -- PLEASE GO ON" r[51] = "IS THAT THE REAL REASON ?" r[52] = "DONT ANY OTHER REASONS COME TO MIND ?" r[53] = "DOES THAT REASON EXPLAIN ANYTHING ELSE ?" r[54] = "WHAT OTHER REASONS MIGHT THERE BE ?" r[55] = "PLEASE DON'T APOLOGIZE !" r[56] = "APOLOGIES ARE NOT NECESSARY" r[57] = "WHAT FEELINGS DO YOU HAVE WHEN YOU APOLOGIZE ?" r[58] = "DON'T BE SO DEFENSIVE" r[59] = "WHAT DOES THAT DREAM SUGGEST TO YOU ?" r[60] = "DO YOU DREAM OFTEN ?" r[61] = "WHAT PERSONS APPEAR IN YOUR DREAMS ?" r[62] = "ARE YOU DISTURBED BY YOUR DREAMS ?" r[63] = "HOW DO YOU DO ... PLEASE STATE YOUR PROBLEM" r[64] = "YOU DON'T SEEM QUITE CERTAIN" r[65] = "WHY THE UNCERTAIN TONE ?" r[66] = "CAN'T YOU BE MORE POSITIVE ?" r[67] = "YOU AREN'T SURE ?" r[68] = "DON'T YOU KNOW ?" r[69] = "WHY NO _ ?" r[70] = "DON'T SAY NO, IT'S ALWAYS SO NEGATIVE" r[71] = "WHY NOT ?" r[72] = "ARE YOU SURE ?" r[73] = "WHY NO ?" r[74] = "WHY ARE YOU CONCERNED ABOUT MY _ ?" r[75] = "WHAT ABOUT YOUR OWN _ ?" r[76] = "CAN'T YOU THINK ABOUT A SPECIFIC EXAMPLE ?" r[77] = "WHEN ?" r[78] = "WHAT ARE YOU THINKING OF ?" r[79] = "REALLY, ALWAYS ?" r[80] = "DO YOU REALLY THINK SO ?" r[81] = "BUT YOU ARE NOT SURE YOU _ " r[82] = "DO YOU DOUBT YOU _ ?" r[83] = "IN WHAT WAY ?" r[84] = "WHAT RESEMBLANCE DO YOU SEE ?" r[85] = "WHAT DOES THE SIMILARITY SUGGEST TO YOU ?" r[86] = "WHAT OTHER CONNECTION DO YOU SEE ?" r[87] = "COULD THERE REALLY BE SOME CONNECTIONS ?" r[88] = "HOW ?" r[89] = "YOU SEEM QUITE POSITIVE" r[90] = "ARE YOU SURE ?" r[91] = "I SEE" r[92] = "I UNDERSTAND" r[93] = "WHY DO YOU BRING UP THE TOPIC OF FRIENDS ?" r[94] = "DO YOUR FRIENDS WORRY YOU ?" r[95] = "DO YOUR FRIENDS PICK ON YOU ?" r[96] = "ARE YOU SURE YOU HAVE ANY FRIENDS ?" r[97] = "DO YOU IMPOSE ON YOUR FRIENDS ?" r[98] = "PERHAPS YOUR LOVE FOR FRIENDS WORRIES YOU" r[99] = "DO COMPUTERS WORRY YOU ?" r[100] = "ARE YOU TALKING ABOUT ME IN PARTICULAR ?" r[101] = "ARE YOU FRIGHTENED BY MACHINES ?" r[102] = "WHY DO YOU MENTION COMPUTERS ?" r[103] = "WHAT DO YOU THINK MACHINES HAVE TO DO WITH YOUR PROBLEMS ?" r[104] = "DON'T YOU THINK COMPUTERS CAN HELP PEOPLE ?" r[105] = "WHAT IS IT ABOUT MACHINES THAT WORRIES YOU ?" r[106] = "SAY, DO YOU HAVE ANY PSYCHOLOGICAL PROBLEMS ?" r[107] = "WHAT DOES THAT SUGGEST TO YOU ?" r[108] = "I SEE" r[109] = "IM NOT SURE I UNDERSTAND YOU FULLY" r[110] = "COME COME ELUCIDATE YOUR THOUGHTS" r[111] = "CAN YOU ELABORATE ON THAT ?" r[112] = "THAT IS QUITE INTERESTING" r[113] = "WHY DO YOU HAVE PROBLEMS WITH MONEY ?" r[114] = "DO YOU THINK MONEY IS EVERYTHING ?" r[115] = "ARE YOU SURE THAT MONEY IS THE PROBLEM ?" r[116] = "I THINK WE WANT TO TALK ABOUT YOU, NOT ABOUT ME" r[117] = "WHAT'S ABOUT ME ?" r[118] = "WHY DO YOU ALWAYS BRING UP MY NAME ?" # table for looking up answers that # fit to a certain keyword k["CAN YOU"] = "1 2 3" k["CAN I"] = "4 5" k["YOU ARE"] =\ k["YOURE"] = "6 7 8 9" k["I DONT"] = "10 11 12 13" k["I FEEL"] = "14 15 16" k["WHY DONT YOU"] = "17 18 19" k["WHY CANT I"] = "20 21" k["ARE YOU"] = "22 23 24" k["I CANT"] = "25 26 27" k["I AM"] =\ k["IM "] = "28 29 30 31" k["YOU "] = "32 33 34" k["I WANT"] = "35 36 37 38 39" k["WHAT"] =\ k["HOW"] =\ k["WHO"] =\ k["WHERE"] =\ k["WHEN"] =\ k["WHY"] = "40 41 42 43 44 45 46 47 48" k["NAME"] = "49 50" k["CAUSE"] = "51 52 53 54" k["SORRY"] = "55 56 57 58" k["DREAM"] = "59 60 61 62" k["HELLO"] =\ k["HI "] = "63" k["MAYBE"] = "64 65 66 67 68" k[" NO "] = "69 70 71 72 73" k["YOUR"] = "74 75" k["ALWAYS"] = "76 77 78 79" k["THINK"] = "80 81 82" k["LIKE"] = "83 84 85 86 87 88 89" k["YES"] = "90 91 92" k["FRIEND"] = "93 94 95 96 97 98" k["COMPUTER"] = "99 100 101 102 103 104 105" k["-"] = "106 107 108 109 110 111 112" k["MONEY"] = "113 114 115" k["ELIZA"] = "116 117 118" } PK��!�i�� urlchk.awknu��[��BEGIN { if (ARGC != 2) { print "URLCHK - check if URLs have changed" print "IN:\n the file with URLs as a command-line parameter" print " file contains URL, old length, new length" print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080" print "OUT:\n same as file with URLs" print "JK 02.03.1998" exit } URLfile = ARGV[1]; ARGV[1] = "" if (Proxy != "") Proxy = " -v Proxy=" Proxy if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort while ((getline < URLfile) > 0) Length[$1] = $3 + 0 close(URLfile) # now, URLfile is read in and can be updated GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk " for (i in Length) { GetThisHeader = GetHeader i " 2>&1" while ((GetThisHeader \| getline) > 0) if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0 close(GetThisHeader) print i, Length[i], NewLength > URLfile if (Length[i] != NewLength) # report only changed URLs print i, Length[i], NewLength } close(URLfile) } PK��!��l��webgrab.awknu��[��BEGIN { RS = "https?://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]" } RT != "" { command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \ " > doc" NR ".html") print command } PK��!�� N��N��testserv.awknu��[��BEGIN { CGI_setup("GET", "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \ "&percent=a %25 sign", "1.0") for (i in MENU) printf "MENU[\"%s\"] = %s\n", i, MENU[i] for (i in PARAM) printf "PARAM[\"%s\"] = %s\n", i, PARAM[i] for (i in GETARG) printf "GETARG[\"%s\"] = %s\n", i, GETARG[i] } PK��!�Þ��fingerclient.awknu��[��BEGIN { NetService = "/inet/tcp/0/localhost/finger" print "var{name}" \|& NetService while ((NetService \|& getline) > 0) print $0 close(NetService) } PK��!�_9J��remconf.awknu��[��function SetUpServer() { TopHeader = "<HTML><title>Remote Configuration</title>" TopDoc = "<BODY>\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\ <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\ <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\ <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\ </UL>" TopFooter = "</BODY></HTML>" if (ConfigFile == "") ConfigFile = "config.asc" } function HandleGET() { if (MENU[2] == "AboutServer") { Document = "This is a GUI for remote configuration of an\ embedded system. It is is implemented as one GAWK script." } else if (MENU[2] == "ReadConfig") { RS = "\n" while ((getline < ConfigFile) > 0) config[$1] = $2; close(ConfigFile) RS = "\r\n" Document = "Configuration has been read." } else if (MENU[2] == "CheckConfig") { Document = "<TABLE BORDER=1 CELLPADDING=5>" for (i in config) Document = Document "<TR><TD>" i "</TD>" \ "<TD>" config[i] "</TD></TR>" Document = Document "</TABLE>" } else if (MENU[2] == "ChangeConfig") { if ("Param" in GETARG) { # any parameter to set? if (GETARG["Param"] in config) { # is parameter valid? config[GETARG["Param"]] = GETARG["Value"] Document = (GETARG["Param"] " = " GETARG["Value"] ".") } else { Document = "Parameter <b>" GETARG["Param"] "</b> is invalid." } } else { Document = "<FORM method=GET><h4>Change one parameter</h4>\ <TABLE BORDER CELLPADDING=5>\ <TR><TD>Parameter</TD><TD>Value</TD></TR>\ <TR><TD><input type=text name=Param value=\"\" size=20></TD>\ <TD><input type=text name=Value value=\"\" size=40></TD>\ </TR></TABLE><input type=submit value=\"Set\"></FORM>" } } else if (MENU[2] == "SaveConfig") { for (i in config) printf("%s %s\n", i, config[i]) > ConfigFile close(ConfigFile) Document = "Configuration has been saved." } } PK��!�܁�� geturl.awknu��[��BEGIN { if (ARGC != 2) { print "GETURL - retrieve Web page via HTTP 1.0" print "IN:\n the URL as a command-line parameter" print "PARAM(S):\n -v Proxy=MyProxy" print "OUT:\n the page content on stdout" print " the page header on stderr" print "JK 16.05.1997" print "ADR 13.08.2000" exit } URL = ARGV[1]; ARGV[1] = "" if (Proxy == "") Proxy = "127.0.0.1" if (ProxyPort == 0) ProxyPort = 80 if (Method == "") Method = "GET" HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort ORS = RS = "\r\n\r\n" print Method " " URL " HTTP/1.0" \|& HttpService HttpService \|& getline Header print Header > "/dev/stderr" while ((HttpService \|& getline) > 0) printf "%s", $0 close(HttpService) } PK��!��Ò?��?�� panic.awknu��[��BEGIN { RS = ORS = "\r\n" if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \ "</HEAD><BODY><H1>" \ "This site is temporarily out of service." \ "</H1></BODY></HTML>" Len = length(Hello) + length(ORS) while ("awk" != "complex") { print "HTTP/1.0 200 OK" \|& HttpService print "Content-Length: " Len ORS \|& HttpService print Hello \|& HttpService while ((HttpService \|& getline) > 0) continue; close(HttpService) } } PK��!��m?? ��? ��coreserv.awknu��[��# CGI Library and core of a web server # # Juergen Kahrs, Juergen.Kahrs@vr-web.de # with Arnold Robbins, arnold@skeeve.com # September 2000 # Global arrays # GETARG --- arguments to CGI GET command # MENU --- menu items (path names) # PARAM --- parameters of form x=y # Optional variable MyHost contains host address # Optional variable MyPort contains port number # Needs TopHeader, TopDoc, TopFooter # Sets MyPrefix, HttpService, Status, Reason BEGIN { if (MyHost == "") { "uname -n" \| getline MyHost close("uname -n") } if (MyPort == 0) MyPort = 8080 HttpService = "/inet/tcp/" MyPort "/0/0" MyPrefix = "http://" MyHost ":" MyPort SetUpServer() while ("awk" != "complex") { # header lines are terminated this way RS = ORS = "\r\n" Status = 200 # this means OK Reason = "OK" Header = TopHeader Document = TopDoc Footer = TopFooter if (GETARG["Method"] == "GET") { HandleGET() } else if (GETARG["Method"] == "HEAD") { # not yet implemented } else if (GETARG["Method"] != "") { print "bad method", GETARG["Method"] } Prompt = Header Document Footer print "HTTP/1.0", Status, Reason \|& HttpService print "Connection: Close" \|& HttpService print "Pragma: no-cache" \|& HttpService len = length(Prompt) + length(ORS) print "Content-length:", len \|& HttpService print ORS Prompt \|& HttpService # ignore all the header lines while ((HttpService \|& getline) > 0) continue # stop talking to this client close(HttpService) # wait for new client request HttpService \|& getline # do some logging print systime(), strftime(), $0 CGI_setup($1, $2, $3) } } function CGI_setup( method, uri, version, i) { delete GETARG delete MENU delete PARAM GETARG["Method"] = method GETARG["URI"] = uri GETARG["Version"] = version i = index(uri, "?") if (i > 0) { # is there a "?" indicating a CGI request? split(substr(uri, 1, i-1), MENU, "[/:]") split(substr(uri, i+1), PARAM, "&") for (i in PARAM) { PARAM[i] = _CGI_decode(PARAM[i]) j = index(PARAM[i], "=") GETARG[substr(PARAM[i], 1, j-1)] = \ substr(PARAM[i], j+1) } } else { # there is no "?", no need for splitting PARAMs split(uri, MENU, "[/:]") } for (i in MENU) # decode characters in path if (i > 4) # but not those in host name MENU[i] = _CGI_decode(MENU[i]) } function _CGI_decode(str, hexdigs, i, pre, code1, code2, val, result) { hexdigs = "123456789abcdef" i = index(str, "%") if (i == 0) # no work to do return str do { pre = substr(str, 1, i-1) # part before %xx code1 = substr(str, i+1, 1) # first hex digit code2 = substr(str, i+2, 1) # second hex digit str = substr(str, i+3) # rest of string code1 = tolower(code1) code2 = tolower(code2) val = index(hexdigs, code1) * 16 \ + index(hexdigs, code2) result = result pre sprintf("%c", val) i = index(str, "%") } while (i != 0) if (length(str) > 0) result = result str return result } PK��!�� mobag.awknu��[��BEGIN { if (ARGC != 2) { print "MOBAG - a simple mobile agent" print "CALL:\n gawk -f mobag.awk mobag.awk" print "IN:\n the name of this script as a command-line parameter" print "PARAM:\n -v MyOrigin=myhost.com" print "OUT:\n the result on stdout" print "JK 29.03.1998 01.04.1998" exit } if (MyOrigin == "") { "uname -n" \| getline MyOrigin close("uname -n") } } #ReadMySelf /^function / { FUNC = $2 } /^END/ \|\| /^#ReadMySelf/ { FUNC = $1 } FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 } (FUNC != "") && (/^}/ \|\| /^#EndOfMySelf/) \ { FUNC = "" } #EndOfMySelf function migrate(Destination, MobCode, Label) { MOBVAR["Label"] = Label MOBVAR["Destination"] = Destination RS = ORS = "\r\n" HttpService = "/inet/tcp/0/" Destination for (i in MOBFUN) MobCode = (MobCode "\n" MOBFUN[i]) MobCode = MobCode "\n\nBEGIN {" for (i in MOBVAR) MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"") MobCode = MobCode "\n}\n" print "POST /cgi-bin/PostAgent.sh HTTP/1.0" \|& HttpService print "Content-length:", length(MobCode) ORS \|& HttpService printf "%s", MobCode \|& HttpService while ((HttpService \|& getline) > 0) print $0 close(HttpService) } END { if (ARGC != 2) exit # stop when called with wrong parameters if (MyOrigin != "") # is this the originating host? MyInit() # if so, initialize the application else # we are on a host with migrated data MyJob() # so we do our job } function MyInit() { MOBVAR["MyOrigin"] = MyOrigin MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80" split(MOBVAR["Machines"], Machines) # which host is the first? migrate(Machines[1], "", "") # go to the first host while (("/inet/tcp/8080/0/0" \|& getline) > 0) # wait for result print $0 # print result close("/inet/tcp/8080/0/0") } function MyJob() { # forget this host sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":" while (("who" \| getline) > 0) # who is logged in? MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0 close("who") if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit? split(MOBVAR["Machines"], Machines) # which host is next? migrate(Machines[1], "", "") # go there } else { # no more machines gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin print MOBVAR["Result"] \|& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080" close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080") } } PK��!�m%��protbase.resultnu��[��Sequences producing significant alignments: (bits) Value gb\|AC021182.14\|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 gb\|AC021056.12\|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 emb\|AL160278.10\|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 emb\|AL391139.11\|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 emb\|AL365192.6\|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 emb\|AL138812.9\|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 gb\|AC073881.3\|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20 PK��!��protbase.requestnu��[��PROGRAM blastn DATALIB month EXPECT 0.75 BEGIN >GAWK310 the gawking gene GNU AWK tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat caccaccatggacagcaaa PK��!�FG��PostAgent.shnu��[��#!/bin/sh MobAg=/tmp/MobileAgent.$$ # direct script to mobile agent file cat > $MobAg # execute agent concurrently gawk -f $MobAg $MobAg > /dev/null & # HTTP header, terminator and body gawk 'BEGIN { print "\r\nAgent started" }' rm $MobAg # delete script file of agent PK��!�~�$��hello-serv.awknu��[��BEGIN { RS = ORS = "\r\n" HttpService = "/inet/tcp/8080/0/0" Hello = "<HTML><HEAD>" \ "<TITLE>A Famous Greeting</TITLE></HEAD>" \ "<BODY><H1>Hello, world</H1></BODY></HTML>" Len = length(Hello) + length(ORS) print "HTTP/1.0 200 OK" \|& HttpService print "Content-Length: " Len ORS \|& HttpService print Hello \|& HttpService while ((HttpService \|& getline) > 0) continue; close(HttpService) } PK��!�v�>��stoxpred.awknu��[��BEGIN { Init() ReadQuotes() CleanUp() Prediction() Report() SendMail() } function Init() { if (ARGC != 1) { print "STOXPRED - daily stock share prediction" print "IN:\n no parameters, nothing on stdin" print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80" print "OUT:\n commented predictions as email" print "JK 09.10.2000" exit } # Remember ticker symbols from Dow Jones Industrial Index StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \ SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \ MRK XOM EK IP", name); # Remember the current date as the end of the time series day = strftime("%d") month = strftime("%m") year = strftime("%Y") if (Proxy == "") Proxy = "chart.yahoo.com" if (ProxyPort == 0) ProxyPort = 80 YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort } function ReadQuotes() { # Retrieve historical data for each ticker symbol FS = "," for (stock = 1; stock <= StockCount; stock++) { URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \ "&a=" month "&b=" day "&c=" year-1 \ "&d=" month "&e=" day "&f=" year \ "g=d&q=q&y=0&z=" name[stock] "&x=.csv" printf("GET " URL " HTTP/1.0\r\n\r\n") \|& YahooData while ((YahooData \|& getline) > 0) { if (NF == 6 && $1 ~ /Jan\|Feb\|Mar\|Apr\|May\|Jun\|Jul\|Aug\|Sep\|Oct\|Nov\|Dec/) { if (stock == 1) days[++daycount] = $1; quote[$1, stock] = $5 } } close(YahooData) } FS = " " } function CleanUp() { # clean up time series; eliminate incomplete data sets for (d = 1; d <= daycount; d++) { for (stock = 1; stock <= StockCount; stock++) if (! ((days[d], stock) in quote)) stock = StockCount + 10 if (stock > StockCount + 1) continue datacount++ for (stock = 1; stock <= StockCount; stock++) data[datacount, stock] = int(0.5 + quote[days[d], stock]) } delete quote delete days } function Prediction() { # Predict each ticker symbol by prolonging yesterday's trend for (stock = 1; stock <= StockCount; stock++) { if (data[1, stock] > data[2, stock]) { predict[stock] = "up" } else if (data[1, stock] < data[2, stock]) { predict[stock] = "down" } else { predict[stock] = "neutral" } if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock])) hot[stock] = 1 if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock])) avoid[stock] = 1 } # Do a plausibility check: how many predictions proved correct? for (s = 1; s <= StockCount; s++) { for (d = 1; d <= datacount-2; d++) { if (data[d+1, s] > data[d+2, s]) { UpCount++ } else if (data[d+1, s] < data[d+2, s]) { DownCount++ } else { NeutralCount++ } if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) \|\| ((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) \|\| ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s]))) CorrectCount++ } } } function Report() { # Generate report report = "\nThis is your daily " report = report "stock market report for "strftime("%A, %B %d, %Y")".\n" report = report "Here are the predictions for today:\n\n" for (stock = 1; stock <= StockCount; stock++) report = report "\t" name[stock] "\t" predict[stock] "\n" for (stock in hot) { if (HotCount++ == 0) report = report "\nThe most promising shares for today are these:\n\n" report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" } for (stock in avoid) { if (AvoidCount++ == 0) report = report "\nThe stock shares to avoid today are these:\n\n" report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \ tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n" } report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0 report = report " losers. When using this kind\nof prediction scheme for" report = report " the 12 months which lie behind us,\nwe get " UpCount report = report " 'ups' and " DownCount " 'downs' and " NeutralCount report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount report = report " predictions " CorrectCount " proved correct next day.\n" report = report "A success rate of "\ int(100CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n" report = report "Random choice would have produced a 33% success rate.\n" report = report "Disclaimer: Like every other prediction of the stock\n" report = report "market, this report is, of course, complete nonsense.\n" report = report "If you are stupid enough to believe these predictions\n" report = report "you should visit a doctor who can treat your ailment." } function SendMail() { # send report to customers customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge" customer["more@utopia.org" ] = "Sir Thomas More" customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza" customer["marx@highgate.uk" ] = "Karl Marx" customer["keynes@the.long.run" ] = "John Maynard Keynes" customer["bierce@devil.hell.org" ] = "Ambrose Bierce" customer["laplace@paris.fr" ] = "Pierre Simon de Laplace" for (c in customer) { MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c print "Good morning " customer[c] "," \| MailPipe print report "\n.\n" \| MailPipe close(MailPipe) } } PK��!�^�1��stoxdata.txtnu��[��Date,Open,High,Low,Close,Volume 9-Oct-00,22.75,22.75,21.375,22.375,7888500 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 5-Oct-00,24.4375,24.625,23.125,23.50,5810300 PK��!�9�:��statist.awknu��[��function SetUpServer() { TopHeader = "<HTML><title>Statistics with GAWK</title>" TopDoc = "<BODY>\ <h2>Please choose one of the following actions:</h2>\ <UL>\ <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\ <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\ </UL>" TopFooter = "</BODY></HTML>" GnuPlot = "gnuplot 2>&1" m1=m2=0; v1=v2=1; n1=n2=10 } function HandleGET() { if (MENU[2] == "AboutServer") { Document = "This is a GUI for a statistical computation.\ It compares means and variances of two distributions.\ It is implemented as one GAWK script and uses GNUPLOT." } else if (MENU[2] == "EnterParameters") { Document = "" if ("m1" in GETARG) { # are there parameters to compare? Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\ setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\ "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>" m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"] m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"] t = (m1-m2)/sqrt(v1/n1+v2/n2) df = (v1/n1+v2/n2)(v1/n1+v2/n2)/((v1/n1)(v1/n1)/(n1-1) \ + (v2/n2)(v2/n2) /(n2-1)) if (v1>v2) { f = v1/v2 df1 = n1 - 1 df2 = n2 - 1 } else { f = v2/v1 df1 = n2 - 1 df2 = n1 - 1 } print "pt=ibeta(" df/2 ",0.5," df/(df+tt) ")" \|& GnuPlot print "pF=2.0ibeta(" df2/2 "," df1/2 "," \ df2/(df2+df1f) ")" \|& GnuPlot print "print pt, pF" \|& GnuPlot RS="\n"; GnuPlot \|& getline; RS="\r\n" # $1 is pt, $2 is pF print "invsqrt2pi=1.0/sqrt(2.0pi)" \|& GnuPlot print "nd(x)=invsqrt2pi/sdexp(-0.5((x-mu)/sd)*2)" \|& GnuPlot print "set term png small color" \|& GnuPlot #print "set term postscript color" \|& GnuPlot #print "set term gif medium size 320,240" \|& GnuPlot print "set yrange[-0.3:]" \|& GnuPlot print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" \|& GnuPlot print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" \|& GnuPlot print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\ mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" \|& GnuPlot print "quit" \|& GnuPlot GnuPlot \|& getline Image while ((GnuPlot \|& getline) > 0) Image = Image RS $0 close(GnuPlot) } Document = Document "\ <h3>Do these samples have the same Gaussian distribution?</h3>\ <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\ <TR>\ <TD>1. Mean </TD> <TD><input type=text name=m1 value=" m1 " size=8></TD>\ <TD>1. Variance</TD> <TD><input type=text name=v1 value=" v1 " size=8></TD>\ <TD>1. Count </TD> <TD><input type=text name=n1 value=" n1 " size=8></TD>\ </TR><TR>\ <TD>2. Mean </TD> <TD><input type=text name=m2 value=" m2 " size=8></TD>\ <TD>2. Variance</TD> <TD><input type=text name=v2 value=" v2 " size=8></TD>\ <TD>2. Count </TD> <TD><input type=text name=n2 value=" n2 " size=8></TD>\ </TR> <input type=submit value=\"Compute\">\ </TABLE></FORM><BR>" } else if (MENU[2] ~ "Image") { Reason = "OK" ORS "Content-type: image/png" #Reason = "OK" ORS "Content-type: application/x-postscript" #Reason = "OK" ORS "Content-type: image/gif" Header = Footer = "" Document = Image } } PK��!�#��if-post-down.d/chronynu�ȯ��PK��!��mX��X��if-pre-up.d/ethtoolnu�ȯ��PK��!�~��q��if-up.d/ethtoolnu�ȯ��PK��!�#��E ��if-up.d/chronynu�ȯ��PK��!�� ¸�� 80-vm-vt.networknu��[��PK��!�~�� 80-container-host0.networknu��[��PK��!�kb!{N��N��80-wifi-adhoc.networknu��[��PK��!��v��80-container-vz.networknu��[��PK��!��n��80-container-ve.networknu��[��PK��!�K�3,��,��73-usb-net-by-mac.linknu��[��PK��!��H��4��99-default.linknu��[��PK��!�8�Sf��f��f��80-wifi-ap.network.examplenu��[��PK��!��@��@��80-wifi-station.network.examplenu��[��PK��!��9#��protbase.awknu��[��PK��!�w�5�_ ��_ ��q��maze.awknu��[��PK��!��'��'�� '��eliza.awknu��[��PK��!�i�� -O��urlchk.awknu��[��PK��!��l��S��webgrab.awknu��[��PK��!�� N��N��zT��testserv.awknu��[��PK��!�Þ��V��fingerclient.awknu��[��PK��!�_9J��V��remconf.awknu��[��PK��!�܁�� _��geturl.awknu��[��PK��!��Ò?��?�� b��panic.awknu��[��PK��!��m?? ��? ��oe��coreserv.awknu��[��PK��!�� r��mobag.awknu��[��PK��!�m%��<~��protbase.resultnu��[��PK��!��protbase.requestnu��[��PK��!�FG��߁��PostAgent.shnu��[��PK��!�~�$��-��hello-serv.awknu��[��PK��!�v�>��:��stoxpred.awknu��[��PK��!�^�1��{��stoxdata.txtnu��[��PK��!�9�:��\��statist.awknu��[��PK��

| ver. 1.4 | Github | . | PHP 8.3.30 | Generation time: 0.04 | proxy | phpinfo | Settings